Amino acids corresponding to resistance-associated changes in HIV-1 were detected at positions 72I, 95K, 125K, 154I, 165I, 201I, 203M, and 263K of the HIV-2 integrase protein (Determine 2, yellow boxes). data suggest that HIV-2 is usually susceptible to the new class of HIV integrase inhibitors. We hypothesize that intrinsic HIV-2 integrase variation at secondary HIV-1 INI-resistance sites may affect the genetic barrier to HIV-2 INI resistance. Further Levosimendan studies will be needed to assess INI efficacy as part of combination antiretroviral therapy in HIV-2Cinfected patients. Introduction HIV-2 is usually endemic in West Africa and has limited spread to a number of other locales worldwide [1]. Compared to HIV-1, HIV-2 contamination is usually characterized by a much longer asymptomatic stage, lower plasma viral loads, slower decline in CD4 counts, decreased mortality rate due to AIDS, and lower rates of genital tract shedding, mother to child transmission, and sexual transmission [1], [2], [3], [4], [5], [6], [7]. Nonetheless, a significant proportion of HIV-2Cinfected individuals eventually progress to AIDS and may benefit from antiretroviral therapy (ART) [3], [8]. Treatment of HIV-2 contamination is usually complicated by the intrinsic resistance of the virus to non-nucleoside reverse transcriptase inhibitors (NNRTIs) and the fusion inhibitor T-20 (enfuvirtide) [9], [10]. Snap23 In addition, HIV-2 exhibits a low genetic barrier to nucleoside reverse transcriptase inhibitor (NRTI) resistance and is partially resistant to several protease inhibitors (PIs) [9], [10], [11], [12], [13]. In preliminary studies, the integrase inhibitors (INIs) raltegravir, elvitegravir and S/GSK1349572 have shown activity against a limited number of wild-type HIV-2 strains [14], [15], [16] and genotypic surveys from Europe suggest that primary mutations leading to INI resistance in HIV-1 are rare in HIV-2 sequences from INI-na?ve individuals [15], [17], [18]. Anecdotal clinical reports suggest that raltegravir-containing regimens can initially suppress HIV-2 plasma RNA loads and may therefore be useful for treating HIV-2 infection [19], [20], [21], [22], [23], [24], [25]. However, the long-term therapeutic benefits of raltegravir and other INIs will likely be compromised by emergent drug resistance, as evidenced by the appearance of resistance-associated mutations in sequences from raltegravir-treated HIV-2 patients [19], [20], [21], [22], [23], [24], [25]. Although a small sampling of patient-derived and (nucleotides 4738 to 5777, numbered as per HIV-2ROD, GenBank accession # “type”:”entrez-nucleotide”,”attrs”:”text”:”M15390″,”term_id”:”1332361″,”term_text”:”M15390″M15390). Briefly, PCR was performed using 0.1C0.25 micrograms of PBMC DNA per reaction. Nested primers for PCR amplification were as follows: first round forward, H2AB_INT F1 ( em class=”gene” AAR GAA GCA RTM TAT GTW GSA TGG GTS CCA GC /em ); first round reverse, H2AB_INT R1 ( em class=”gene” GGA CAA TAW CTT TTC YCC YCT GAT GGC TCT YCT TAC TTC /em ); second round forward, H2AB_INT F2 ( em class=”gene” CAG GAA GTA GAY CAY TTA GTR AGT CAR GG /em ); second round reverse, H2AB_INT R2 ( em class=”gene” GGG AAT ATT ACY CTR CTG CAA GTC CAC C /em ). Reaction conditions and thermal cycling parameters were as previously described [26], [27]. All PCR amplifications were performed using Levosimendan procedural safeguards to prevent contamination including aliquoting of all reagents and physical separation of sample processing and post-PCR handling steps. In addition, negative control reactions that lacked template DNA were included in every PCR experiment, and reactions containing 10 genome equivalents of HIV-2 DNA (pROD10) were used to monitor PCR amplification efficiency. Bulk PCR products were agarose gel-purified (S.N.A.P. UV-Free Gel Purification Kit, Invitrogen) and sequenced via standard dideoxy- chain termination methods using primers H2AB_INT_seqR ( Levosimendan em class=”gene” AAATTCATGCAATGAACTGCC /em ), H2AB_INT_seqF ( em class=”gene” TAGTAGAAGCAATGAATCACC /em ), H2AB_INT F2 and H2AB_INT R2 (see above). Genbank Accession numbers of the HIV-2 sequences from this study: “type”:”entrez-nucleotide-range”,”attrs”:”text”:”JF811132-JF811253″,”start_term”:”JF811132″,”end_term”:”JF811253″,”start_term_id”:”342209305″,”end_term_id”:”342209426″JF811132-JF811253. Phylogenetic analyses and resistance-associated genotyping All patient-derived sequences were assessed for potential sample mix-up and contamination as recommended by the Division of AIDS, National Institute of Allergy and Infectious Diseases, National Institutes of Health (http://www.hiv.lanl.gov/content/sequence/TUTORIALS/CONTAM/contam_main.html). HIV-2 patient sequences were aligned with reference sequences from the Los Alamos National Laboratory HIV Database (http://hiv-web.lanl.gov) using Muscle (http://www.ebi.ac.uk/Tools/msa/muscle) followed by manual adjustment using.